Transcript: Mouse NM_146377.1

Mus musculus olfactory receptor 127 (Olfr127), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr127 (258374)
Length:
972
CDS:
1..972

Additional Resources:

NCBI RefSeq record:
NM_146377.1
NBCI Gene record:
Olfr127 (258374)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184856 CTTCTCCTATTGCCAGATATT pLKO.1 645 CDS 100% 13.200 7.920 N Olfr127 n/a
2 TRCN0000186784 GCACCTTTCCATTATGGACTT pLKO.1 192 CDS 100% 4.050 2.430 N Olfr127 n/a
3 TRCN0000203641 CAGCAGGGAACTTCATCATTA pLKO.1 116 CDS 100% 13.200 6.600 Y Olfr128 n/a
4 TRCN0000186752 GAGGTATCTCAGGAACATTAT pLKO.1 455 CDS 100% 13.200 6.600 Y Olfr126 n/a
5 TRCN0000185888 GTCTACTTTCATTGCTGTAAT pLKO.1 597 CDS 100% 13.200 6.600 Y Olfr127 n/a
6 TRCN0000202504 CAGTCTCCAATGTATTACTTT pLKO.1 166 CDS 100% 5.625 2.813 Y Olfr113 n/a
7 TRCN0000204555 CCACTGCACTATGAGGTCATA pLKO.1 385 CDS 100% 4.950 2.475 Y Olfr127 n/a
8 TRCN0000186880 GACTACTGAAAGTGTCTACTT pLKO.1 584 CDS 100% 4.950 2.475 Y Olfr128 n/a
9 TRCN0000188869 GCTGCAGATCTTACAGGCTTT pLKO.1 66 CDS 100% 4.050 2.025 Y Olfr115 n/a
10 TRCN0000186122 CAGGAACATTATTCACAGCAA pLKO.1 464 CDS 100% 2.640 1.320 Y Olfr126 n/a
11 TRCN0000204852 GCCTATCTAAAGCCAACCTCA pLKO.1 772 CDS 100% 2.640 1.320 Y Olfr761 n/a
12 TRCN0000188773 GCTTTGCTCTTCTTGGTGACA pLKO.1 82 CDS 100% 2.640 1.320 Y Olfr115 n/a
13 TRCN0000186979 CCATTCTCACAGTGATGTCAT pLKO.1 338 CDS 100% 4.950 2.475 Y Olfr115 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.