Transcript: Mouse NM_146452.2

Mus musculus olfactory receptor 694 (Olfr694), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr694 (258444)
Length:
948
CDS:
1..948

Additional Resources:

NCBI RefSeq record:
NM_146452.2
NBCI Gene record:
Olfr694 (258444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185567 CCAAAGGCCATACTAGATTAT pLKO.1 235 CDS 100% 13.200 6.600 Y Olfr694 n/a
2 TRCN0000185992 CCTCCTACTCACTAATTCTAT pLKO.1 647 CDS 100% 5.625 2.813 Y Olfr694 n/a
3 TRCN0000185919 CTCTGAACTATACAATCCTAA pLKO.1 386 CDS 100% 4.950 2.475 Y Olfr694 n/a
4 TRCN0000186117 CCATGCAATATCCTTTCTGCA pLKO.1 488 CDS 100% 2.640 1.320 Y Olfr694 n/a
5 TRCN0000186020 CCACATATGAACTCATGGTTT pLKO.1 578 CDS 100% 0.000 0.000 Y Olfr694 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.