Transcript: Mouse NM_146453.2

Mus musculus olfactory receptor 693 (Olfr693), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr693 (258445)
Length:
952
CDS:
2..952

Additional Resources:

NCBI RefSeq record:
NM_146453.2
NBCI Gene record:
Olfr693 (258445)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204840 GCCTCAGTTATCAGTCCCAAA pLKO.1 221 CDS 100% 4.050 5.670 N Olfr693 n/a
2 TRCN0000186812 GAAGAAAGAAAGCCCTTGTTA pLKO.1 699 CDS 100% 5.625 3.938 N Olfr693 n/a
3 TRCN0000203413 CCAGATATCAACTCATGGTTT pLKO.1 579 CDS 100% 4.950 3.465 N Olfr693 n/a
4 TRCN0000187360 CTATCTCTCATGGACCTTCTT pLKO.1 197 CDS 100% 4.950 3.465 N Olfr693 n/a
5 TRCN0000187939 GAACTGCTCTGTGCTACAATT pLKO.1 74 CDS 100% 13.200 7.920 N OR2AG1 n/a
6 TRCN0000188887 GCCCTTCAGATGTTCTTGGAA pLKO.1 293 CDS 100% 3.000 1.800 N Olfr693 n/a
7 TRCN0000204273 CCTGTACATGTTGGCACTGAT pLKO.1 100 CDS 100% 4.950 2.475 Y Olfr693 n/a
8 TRCN0000185992 CCTCCTACTCACTAATTCTAT pLKO.1 648 CDS 100% 5.625 2.813 Y Olfr694 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.