Transcript: Mouse NM_146456.2

Mus musculus olfactory receptor 92 (Olfr92), mRNA.

Source:
NCBI, updated 2012-08-26
Taxon:
Mus musculus (mouse)
Gene:
Olfr92 (258448)
Length:
939
CDS:
1..939

Additional Resources:

NCBI RefSeq record:
NM_146456.2
NBCI Gene record:
Olfr92 (258448)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186210 CAGATAGACAACTTTCTGTGT pLKO.1 511 CDS 100% 2.640 2.112 N Olfr92 n/a
2 TRCN0000204186 GATGGCTGTTGCTAGTATCTT pLKO.1 588 CDS 100% 5.625 3.938 N Olfr92 n/a
3 TRCN0000186813 GCTGTTGCTAGTATCTTCATT pLKO.1 592 CDS 100% 5.625 3.938 N Olfr92 n/a
4 TRCN0000187641 GCTGAAGATAAGCTCTGCAAA pLKO.1 669 CDS 100% 4.950 2.970 N Olfr92 n/a
5 TRCN0000189142 GAGCCTCATCCTTGTCTCTTA pLKO.1 627 CDS 100% 4.950 2.475 Y Olfr92 n/a
6 TRCN0000189083 GCTGTTTATCTGCAGCCCAAA pLKO.1 763 CDS 100% 4.050 2.025 Y Olfr92 n/a
7 TRCN0000189343 CCTTGTCTCTTATGGTGCCAT pLKO.1 636 CDS 100% 2.640 1.320 Y Olfr90 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.