Transcript: Mouse NM_146459.2

Mus musculus olfactory receptor 1215 (Olfr1215), mRNA.

Source:
NCBI, updated 2018-05-28
Taxon:
Mus musculus (mouse)
Gene:
Olfr1215 (258451)
Length:
943
CDS:
5..943

Additional Resources:

NCBI RefSeq record:
NM_146459.2
NBCI Gene record:
Olfr1215 (258451)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220985 GTTGAGAAGCTCCTATTTGTT pLKO.1 65 CDS 100% 5.625 3.938 N Olfr1215 n/a
2 TRCN0000220986 CATTGCTTCGAGTCCTGTGTT pLKO.1 142 CDS 100% 4.950 3.465 N Olfr1215 n/a
3 TRCN0000220987 CCCACATTACTGTTGTGGTTT pLKO.1 726 CDS 100% 0.495 0.248 Y Olfr1215 n/a
4 TRCN0000030178 CTCCTCTATTGTCACACCCAA pLKO.1 220 CDS 100% 2.640 1.848 N Olfr1215 n/a
5 TRCN0000188753 GCCATTTGTAAGCCCTTGCTT pLKO.1 374 CDS 100% 3.000 1.500 Y Olfr968 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.