Transcript: Mouse NM_146472.2

Mus musculus olfactory receptor 1384 (Olfr1384), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr1384 (258464)
Length:
1034
CDS:
23..979

Additional Resources:

NCBI RefSeq record:
NM_146472.2
NBCI Gene record:
Olfr1384 (258464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202673 CCCAAACTTCTAATCAGTCTT pLKO.1 254 CDS 100% 4.950 3.960 N Olfr1384 n/a
2 TRCN0000203492 CTGTGGCAACATCACCATTAT pLKO.1 136 CDS 100% 13.200 9.240 N Olfr1384 n/a
3 TRCN0000203564 GTTCTCACTCAACAAGACCTT pLKO.1 158 CDS 100% 2.640 1.848 N Olfr1384 n/a
4 TRCN0000186211 CCAGTTCTTCATAGCACTCTT pLKO.1 316 CDS 100% 4.950 2.970 N Olfr1384 n/a
5 TRCN0000189352 CCATCACCTGAACCACTTCTT pLKO.1 529 CDS 100% 4.950 2.475 Y Olfr1383 n/a
6 TRCN0000186509 GCAGTGTTGAAGATCAAGTCA pLKO.1 686 CDS 100% 3.000 1.500 Y Olfr1384 n/a
7 TRCN0000188506 CCACTTCTTCTGTGAGATGCT pLKO.1 541 CDS 100% 2.640 1.320 Y Olfr1384 n/a
8 TRCN0000188178 CCCATGTACTTCTTCCTTGCA pLKO.1 191 CDS 100% 2.640 1.320 Y Olfr525 n/a
9 TRCN0000187685 CCATGTACTTCTTCCTTGCTA pLKO.1 192 CDS 100% 3.000 1.500 Y Olfr8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.