Transcript: Mouse NM_146563.1

Mus musculus olfactory receptor 18 (Olfr18), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Olfr18 (18315)
Length:
1156
CDS:
130..1125

Additional Resources:

NCBI RefSeq record:
NM_146563.1
NBCI Gene record:
Olfr18 (18315)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146563.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226067 CTGCATAATTCAGTAGTATTA pLKO_005 667 CDS 100% 13.200 10.560 N Olfr18 n/a
2 TRCN0000218739 CTTTGCACTACCAGTTCATTA pLKO_005 581 CDS 100% 13.200 9.240 N Olfr18 n/a
3 TRCN0000226069 TCTGATACCTTTACCAATAAC pLKO_005 763 CDS 100% 13.200 9.240 N Olfr18 n/a
4 TRCN0000226070 CCATCACCTGGTGGGAAATAT pLKO_005 880 CDS 100% 15.000 9.000 N Olfr18 n/a
5 TRCN0000226068 CTTCAAGAGTGTGGATATTTC pLKO_005 699 CDS 100% 13.200 7.920 N Olfr18 n/a
6 TRCN0000185048 CCTGTCAGTTGTTTGCTTATT pLKO.1 927 CDS 100% 13.200 6.600 Y Olfr869 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146563.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.