Transcript: Mouse NM_146610.1

Mus musculus olfactory receptor 972 (Olfr972), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr972 (258603)
Length:
945
CDS:
1..945

Additional Resources:

NCBI RefSeq record:
NM_146610.1
NBCI Gene record:
Olfr972 (258603)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146610.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186664 GATTTCTGTAACGCCAATGTA pLKO.1 499 CDS 100% 5.625 3.938 N Olfr972 n/a
2 TRCN0000189055 GCCAGCATCCTCCAGATTAAA pLKO.1 667 CDS 100% 15.000 9.000 N Olfr972 n/a
3 TRCN0000186237 CCTGGATGATATTTGGTGTAT pLKO.1 425 CDS 100% 4.950 2.970 N Olfr972 n/a
4 TRCN0000187618 GCTGTTGCTATCTTCTTTGGT pLKO.1 739 CDS 100% 3.000 1.800 N Olfr972 n/a
5 TRCN0000187524 GCTATCTTCTTTGGTTCCCTT pLKO.1 745 CDS 100% 2.640 1.584 N Olfr972 n/a
6 TRCN0000186540 GAGTTCAATCTTGCTGGTTTA pLKO.1 31 CDS 100% 10.800 5.400 Y Olfr968 n/a
7 TRCN0000203773 CCGCTATGTTGCCATTTGTAA pLKO.1 363 CDS 100% 5.625 2.813 Y Olfr972 n/a
8 TRCN0000185212 CTGATACTATTCAGTTCTCAA pLKO.1 142 CDS 100% 4.950 2.475 Y Olfr968 n/a
9 TRCN0000203399 CCCTTGCTTTACAATGCTGTA pLKO.1 385 CDS 100% 4.050 2.025 Y Olfr970 n/a
10 TRCN0000188753 GCCATTTGTAAGCCCTTGCTT pLKO.1 373 CDS 100% 3.000 1.500 Y Olfr968 n/a
11 TRCN0000203180 GTGAAGAACATCATCTCCTAT pLKO.1 262 CDS 100% 4.950 2.475 Y Olfr970 n/a
12 TRCN0000185264 GCTCTTACATCTTCATCATTA pLKO.1 647 CDS 100% 13.200 6.600 Y Olfr955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146610.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.