Transcript: Mouse NM_146612.2

Mus musculus olfactory receptor 968 (Olfr968), mRNA.

Source:
NCBI, updated 2012-09-01
Taxon:
Mus musculus (mouse)
Gene:
Olfr968 (258605)
Length:
1027
CDS:
1..945

Additional Resources:

NCBI RefSeq record:
NM_146612.2
NBCI Gene record:
Olfr968 (258605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000203376 CCTGGATGATATTTGGAGTAT pLKO.1 425 CDS 100% 4.950 2.970 N Olfr968 n/a
2 TRCN0000186540 GAGTTCAATCTTGCTGGTTTA pLKO.1 31 CDS 100% 10.800 5.400 Y Olfr968 n/a
3 TRCN0000203773 CCGCTATGTTGCCATTTGTAA pLKO.1 363 CDS 100% 5.625 2.813 Y Olfr972 n/a
4 TRCN0000204567 CTCAGCAGTCTGTCCTTCATT pLKO.1 187 CDS 100% 5.625 2.813 Y Olfr1537 n/a
5 TRCN0000185212 CTGATACTATTCAGTTCTCAA pLKO.1 142 CDS 100% 4.950 2.475 Y Olfr968 n/a
6 TRCN0000203399 CCCTTGCTTTACAATGCTGTA pLKO.1 385 CDS 100% 4.050 2.025 Y Olfr970 n/a
7 TRCN0000188753 GCCATTTGTAAGCCCTTGCTT pLKO.1 373 CDS 100% 3.000 1.500 Y Olfr968 n/a
8 TRCN0000203892 CCTTCATTGACCTCTGCCATT pLKO.1 200 CDS 100% 4.050 2.025 Y Olfr971 n/a
9 TRCN0000185264 GCTCTTACATCTTCATCATTA pLKO.1 647 CDS 100% 13.200 6.600 Y Olfr955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.