Transcript: Mouse NM_146629.2

Mus musculus olfactory receptor 121 (Olfr121), mRNA.

Source:
NCBI, updated 2013-04-18
Taxon:
Mus musculus (mouse)
Gene:
Olfr121 (258622)
Length:
1253
CDS:
89..1054

Additional Resources:

NCBI RefSeq record:
NM_146629.2
NBCI Gene record:
Olfr121 (258622)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146629.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188174 CGTGGCAGCAATTCTTTGCAT pLKO.1 706 CDS 100% 3.000 4.200 N Olfr121 n/a
2 TRCN0000188923 GCAATCTTCGTGGCAGCAATT pLKO.1 698 CDS 100% 10.800 8.640 N Olfr121 n/a
3 TRCN0000186957 CTGACAGGAAATGAACTCATA pLKO.1 221 CDS 100% 4.950 2.970 N Olfr121 n/a
4 TRCN0000204683 GTCTAGCCACTTACCAGGAAT pLKO.1 895 CDS 100% 4.950 2.970 N Olfr121 n/a
5 TRCN0000204253 CACTCCACTATGCAACACGAA pLKO.1 492 CDS 100% 2.640 1.320 Y Olfr121 n/a
6 TRCN0000204866 GACCACTTCTTCTGTGACCTT pLKO.1 629 CDS 100% 2.640 1.320 Y Olfr121 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146629.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.