Transcript: Mouse NM_146653.1

Mus musculus olfactory receptor 435 (Olfr435), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr435 (258647)
Length:
942
CDS:
1..942

Additional Resources:

NCBI RefSeq record:
NM_146653.1
NBCI Gene record:
Olfr435 (258647)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202882 CTGCTACATCTTTACATTGTT pLKO.1 96 CDS 100% 5.625 3.938 N Olfr435 n/a
2 TRCN0000185136 CATCTTTACATTGTTAGGGAA pLKO.1 102 CDS 100% 2.640 1.848 N Olfr435 n/a
3 TRCN0000185043 CAATCACTTCTTCTGTGAAAT pLKO.1 519 CDS 100% 13.200 6.600 Y Olfr434 n/a
4 TRCN0000184899 CAACACTCAATCAAGTTGTTA pLKO.1 572 CDS 100% 5.625 2.813 Y Olfr435 n/a
5 TRCN0000185609 GACACAACACTCAATCAAGTT pLKO.1 568 CDS 100% 4.950 2.475 Y Olfr441 n/a
6 TRCN0000187562 GCCTCATGAAGTCAATCACTT pLKO.1 507 CDS 100% 4.950 2.475 Y Olfr237-ps1 n/a
7 TRCN0000185680 GTCAATCACTTCTTCTGTGAA pLKO.1 517 CDS 100% 4.950 2.475 Y Olfr441 n/a
8 TRCN0000203811 CTTCTGTGAAATCCTGTCTGT pLKO.1 528 CDS 100% 2.640 1.320 Y OR2A42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.