Transcript: Mouse NM_146670.1

Mus musculus olfactory receptor 815 (Olfr815), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr815 (258665)
Length:
951
CDS:
1..951

Additional Resources:

NCBI RefSeq record:
NM_146670.1
NBCI Gene record:
Olfr815 (258665)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189415 CCATGTCCTATGACCGCTATA pLKO.1 362 CDS 100% 10.800 5.400 Y Olfr814 n/a
2 TRCN0000185054 CCTCCGTAATTTCTCTTTCTT pLKO.1 198 CDS 100% 5.625 2.813 Y Olfr815 n/a
3 TRCN0000203521 CCTCAGTTACAGACTCTGATT pLKO.1 73 CDS 100% 4.950 2.475 Y Olfr815 n/a
4 TRCN0000202644 CTTACTTATGGGAGTTGCATA pLKO.1 760 CDS 100% 4.950 2.475 Y Olfr814 n/a
5 TRCN0000203854 CCGCTATATTGCCATCTGCAA pLKO.1 375 CDS 100% 2.640 1.320 Y Olfr815 n/a
6 TRCN0000203271 GCTTCAAATGTCATTGACCAT pLKO.1 520 CDS 100% 2.640 1.320 Y Olfr815 n/a
7 TRCN0000186039 CATGACACTCATTGTCACATT pLKO.1 624 CDS 100% 0.495 0.248 Y Olfr814 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.