Transcript: Mouse NM_146679.1

Mus musculus olfactory receptor 1427 (Olfr1427), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr1427 (258674)
Length:
936
CDS:
1..936

Additional Resources:

NCBI RefSeq record:
NM_146679.1
NBCI Gene record:
Olfr1427 (258674)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030234 CCTTGTATCCTACACAGTCAT pLKO.1 642 CDS 100% 4.950 3.465 N Olfr1427 n/a
2 TRCN0000030238 GCTTCGAAACCTCTCTGTGTT pLKO.1 186 CDS 100% 4.950 3.465 N Olfr1427 n/a
3 TRCN0000030236 GTTGGTAAATGTCACCATCAT pLKO.1 117 CDS 100% 4.950 3.465 N Olfr1427 n/a
4 TRCN0000030235 CCAGTCTCAAGAACTGAGCTT pLKO.1 54 CDS 100% 2.640 1.848 N Olfr1427 n/a
5 TRCN0000030237 CTATGGTTTGTTCTTCTCCTT pLKO.1 625 CDS 100% 2.640 1.848 N Olfr1427 n/a
6 TRCN0000186727 GCTCCTGATGATCTCAAACAA pLKO.1 588 CDS 100% 5.625 2.813 Y Olfr1423 n/a
7 TRCN0000204807 GTGCCCTGCATCTATGTCTAT pLKO.1 754 CDS 100% 4.950 2.475 Y Olfr1425 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.