Transcript: Mouse NM_146681.1

Mus musculus olfactory receptor 1424 (Olfr1424), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr1424 (258676)
Length:
942
CDS:
1..942

Additional Resources:

NCBI RefSeq record:
NM_146681.1
NBCI Gene record:
Olfr1424 (258676)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146681.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188925 GTAAGCGCAGTGCTCTTTCTT pLKO.1 67 CDS 100% 5.625 7.875 N Olfr1424 n/a
2 TRCN0000187299 CTTACCCAAAGTCAGCAAGTA pLKO.1 49 CDS 100% 4.950 3.960 N Olfr1424 n/a
3 TRCN0000194291 GCTTGCACAGACATTGTTGTT pLKO.1 562 CDS 100% 4.950 3.465 N Olfr1424 n/a
4 TRCN0000188121 CCTGCATTTATGTCTATGCCA pLKO.1 758 CDS 100% 0.750 0.450 N Olfr1424 n/a
5 TRCN0000030293 CCCACTCCATAGTGCAGATTT pLKO.1 461 CDS 100% 13.200 6.600 Y Olfr1426 n/a
6 TRCN0000186719 GCTGCTGATGATTTCCAATAA pLKO.1 588 CDS 100% 13.200 6.600 Y Olfr1425 n/a
7 TRCN0000030290 GATGTTCTTCTTCCACCTTAT pLKO.1 300 CDS 100% 10.800 5.400 Y Olfr1426 n/a
8 TRCN0000186033 CTTGATACTTTCTACTGTGAT pLKO.1 520 CDS 100% 4.950 2.475 Y Olfr1424 n/a
9 TRCN0000030291 GAGCTGCTGATGATTTCCAAT pLKO.1 586 CDS 100% 4.950 2.475 Y Olfr1426 n/a
10 TRCN0000204301 CCCAGGTCATCAAACTTGCTT pLKO.1 545 CDS 100% 3.000 1.500 Y Olfr1424 n/a
11 TRCN0000188356 CCTGGTGTATGTGACAACTCT pLKO.1 96 CDS 100% 3.000 1.500 Y Olfr1425 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146681.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.