Transcript: Mouse NM_146704.1

Mus musculus olfactory receptor 1446 (Olfr1446), mRNA.

Source:
NCBI, updated 2018-05-27
Taxon:
Mus musculus (mouse)
Gene:
Olfr1446 (258699)
Length:
927
CDS:
1..927

Additional Resources:

NCBI RefSeq record:
NM_146704.1
NBCI Gene record:
Olfr1446 (258699)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204361 CTGCCTCTTATGGGATCAGTT pLKO.1 440 CDS 100% 4.950 3.465 N Olfr1446 n/a
2 TRCN0000186059 CTTCTTTACATTGAGAGCTTA pLKO.1 598 CDS 100% 4.950 2.970 N Olfr1446 n/a
3 TRCN0000203909 CTTGGTAATCTGTCCTTGGTT pLKO.1 190 CDS 100% 3.000 1.800 N Olfr1446 n/a
4 TRCN0000188549 CCTGCAATAATGGCTCTCACT pLKO.1 547 CDS 100% 2.640 1.584 N Olfr1446 n/a
5 TRCN0000204235 CTAGGGATGATCCTGCTGATT pLKO.1 130 CDS 100% 4.950 2.475 Y Olfr1446 n/a
6 TRCN0000197342 CTTCAGGACATCACAAGGCTA pLKO.1 695 CDS 100% 2.640 1.320 Y Olfr1447 n/a
7 TRCN0000185894 GATAATCAAGTTAGGGAACAT pLKO.1 574 CDS 100% 4.950 2.475 Y Olfr1447 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.