Transcript: Mouse NM_146709.2

Mus musculus olfactory receptor 411 (Olfr411), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr411 (258704)
Length:
1049
CDS:
91..1038

Additional Resources:

NCBI RefSeq record:
NM_146709.2
NBCI Gene record:
Olfr411 (258704)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146709.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186798 GCAGTTACAGAGTTCATTCTT pLKO.1 121 CDS 100% 5.625 3.938 N Olfr411 n/a
2 TRCN0000189145 GCAGCCAGTCATCTTTGTAGT pLKO.1 168 CDS 100% 4.950 3.465 N Olfr411 n/a
3 TRCN0000204215 CTGTGGCCATATCCACACTTA pLKO.1 578 CDS 100% 0.495 0.297 N Olfr411 n/a
4 TRCN0000203774 CTCACACAGCTCTTCTTCTTT pLKO.1 391 CDS 100% 5.625 2.813 Y Olfr411 n/a
5 TRCN0000188431 CTCAATGAGCTGCTGCTCTTT pLKO.1 679 CDS 100% 4.950 2.475 Y Olfr411 n/a
6 TRCN0000204647 GCCATGGCTTATGACCGATTT pLKO.1 448 CDS 100% 10.800 5.400 Y Olfr502 n/a
7 TRCN0000367805 GCATCTTCTATGGGACAGGTG pLKO_005 845 CDS 100% 2.160 1.080 Y OR3A3 n/a
8 TRCN0000187100 CCCAATGTGATCAATCACTAT pLKO.1 610 CDS 100% 4.950 2.475 Y OR4X2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146709.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.