Transcript: Mouse NM_146714.2

Mus musculus olfactory receptor 248 (Olfr248), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr248 (258709)
Length:
1010
CDS:
26..955

Additional Resources:

NCBI RefSeq record:
NM_146714.2
NBCI Gene record:
Olfr248 (258709)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187875 GTTTGACTTGGGCAGACAGAT pLKO.1 159 CDS 100% 4.950 3.465 N Olfr248 n/a
2 TRCN0000203540 GTGGTCTTTCTTTGCCTGTAT pLKO.1 104 CDS 100% 4.950 2.970 N Olfr248 n/a
3 TRCN0000186184 CCACACTCCTATGTACTACTT pLKO.1 184 CDS 100% 4.950 2.475 Y Olfr248 n/a
4 TRCN0000187833 GCTGGGTACATTCTTGCTCAT pLKO.1 640 CDS 100% 4.050 2.025 Y Olfr248 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.