Transcript: Mouse NM_146716.2

Mus musculus olfactory receptor 432 (Olfr432), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr432 (258711)
Length:
939
CDS:
1..939

Additional Resources:

NCBI RefSeq record:
NM_146716.2
NBCI Gene record:
Olfr432 (258711)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146716.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202815 CGGCTTTATATTGCAGTGATT pLKO.1 586 CDS 100% 4.950 6.930 N Olfr432 n/a
2 TRCN0000188254 CCTCCCATATAACCGTAGTGA pLKO.1 722 CDS 100% 3.000 4.200 N Olfr432 n/a
3 TRCN0000187647 GCAGTGATTGGCATGATCAAT pLKO.1 598 CDS 100% 5.625 3.938 N Olfr432 n/a
4 TRCN0000184866 CATGCAATCTTACTTTCATCT pLKO.1 620 CDS 100% 4.950 3.465 N Olfr432 n/a
5 TRCN0000188512 CCCTGCAACATCTTGCAGTTT pLKO.1 65 CDS 100% 0.495 0.347 N Olfr432 n/a
6 TRCN0000202848 CAGGTACAGAAACAGTTAGTT pLKO.1 415 CDS 100% 5.625 3.375 N Olfr432 n/a
7 TRCN0000203876 CCACTCCCATGTACTTCTTTA pLKO.1 167 CDS 100% 13.200 6.600 Y Olfr432 n/a
8 TRCN0000187525 GCAGGGAACTTGTTCATCATT pLKO.1 118 CDS 100% 5.625 2.813 Y Olfr432 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146716.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.