Transcript: Mouse NM_146725.1

Mus musculus olfactory receptor 516 (Olfr516), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr516 (258720)
Length:
945
CDS:
1..945

Additional Resources:

NCBI RefSeq record:
NM_146725.1
NBCI Gene record:
Olfr516 (258720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146725.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189147 GCACATCCCTATGTACCTGTT pLKO.1 165 CDS 100% 4.050 2.835 N Olfr516 n/a
2 TRCN0000189404 CCAGAGTTTGCACATCCCTAT pLKO.1 156 CDS 100% 4.050 2.430 N Olfr516 n/a
3 TRCN0000203749 CCTATGTACCTGTTTCTGCAA pLKO.1 172 CDS 100% 2.640 1.584 N Olfr516 n/a
4 TRCN0000185009 CTGTTGATACTCTTGTCTTAT pLKO.1 634 CDS 100% 13.200 6.600 Y Olfr512 n/a
5 TRCN0000187560 GCAGACACCTTCCTGTTTGAA pLKO.1 568 CDS 100% 5.625 2.813 Y Olfr518 n/a
6 TRCN0000185401 GCAGATGTACTTCATTCTTCT pLKO.1 297 CDS 100% 4.950 2.475 Y Olfr519 n/a
7 TRCN0000188822 CCATTTCCTTTGGTGGCTGTT pLKO.1 272 CDS 100% 4.050 2.025 Y Olfr519 n/a
8 TRCN0000188049 CCTGTTTGAAGTCTATGCCTT pLKO.1 579 CDS 100% 2.640 1.320 Y Olfr516 n/a
9 TRCN0000187410 CTAGTGAGAAAGCGACCATTT pLKO.1 257 CDS 100% 0.000 0.000 Y Olfr516 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146725.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.