Transcript: Mouse NM_146735.1

Mus musculus olfactory receptor 483 (Olfr483), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Olfr483 (258730)
Length:
948
CDS:
1..948

Additional Resources:

NCBI RefSeq record:
NM_146735.1
NBCI Gene record:
Olfr483 (258730)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186121 CCTCATCGTCACAGTTTACTT pLKO.1 480 CDS 100% 5.625 4.500 N Olfr483 n/a
2 TRCN0000203602 CTTTAGCAGAACTCTCCTGCT pLKO.1 560 CDS 100% 0.216 0.151 N Olfr483 n/a
3 TRCN0000185439 GATTTCATTGCATCCGTTGAA pLKO.1 322 CDS 100% 4.950 2.970 N Olfr483 n/a
4 TRCN0000187295 CCTCATCACCATCCTGAAGAT pLKO.1 675 CDS 100% 4.950 2.475 Y Olfr470 n/a
5 TRCN0000186800 GCTTCTGTTGACATAGGCATT pLKO.1 208 CDS 100% 4.050 2.025 Y Olfr483 n/a
6 TRCN0000189318 CCACTTGGCTTCTGTTGACTT pLKO.1 201 CDS 100% 4.950 2.475 Y Olfr482 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.