Transcript: Mouse NM_146739.1

Mus musculus olfactory receptor 502 (Olfr502), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Olfr502 (258734)
Length:
945
CDS:
1..945

Additional Resources:

NCBI RefSeq record:
NM_146739.1
NBCI Gene record:
Olfr502 (258734)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146739.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204647 GCCATGGCTTATGACCGATTT pLKO.1 358 CDS 100% 10.800 5.400 Y Olfr502 n/a
2 TRCN0000187486 GTAGCCCACTGCTTTATTCAA pLKO.1 389 CDS 100% 5.625 2.813 Y Olfr502 n/a
3 TRCN0000188846 GCTTCTGCTGACATAGGCTAT pLKO.1 208 CDS 100% 4.050 2.025 Y Olfr502 n/a
4 TRCN0000186642 GCTGTCTCCTACATCTACATA pLKO.1 652 CDS 100% 5.625 2.813 Y Olfr472 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146739.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.