Transcript: Mouse NM_146761.2

Mus musculus olfactory receptor 414 (Olfr414), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr414 (258756)
Length:
955
CDS:
1..954

Additional Resources:

NCBI RefSeq record:
NM_146761.2
NBCI Gene record:
Olfr414 (258756)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185682 GCAATTTATCTGTTGACGTTA pLKO.1 97 CDS 100% 4.950 6.930 N Olfr414 n/a
2 TRCN0000204254 CCTTCGTTACCCTAGTCTCAT pLKO.1 387 CDS 100% 4.950 3.960 N Olfr414 n/a
3 TRCN0000184869 CATGTACACCTTCAACTACAA pLKO.1 792 CDS 100% 4.950 3.465 N Olfr414 n/a
4 TRCN0000204502 CTACTACTCGTCCACTCTCTT pLKO.1 750 CDS 100% 4.950 3.465 N Olfr414 n/a
5 TRCN0000189374 CCTCACTTGTTCAGACAAGGA pLKO.1 558 CDS 100% 0.264 0.185 N Olfr414 n/a
6 TRCN0000184956 CCCAATATCATCAACCACTTT pLKO.1 511 CDS 100% 4.950 2.970 N Olfr414 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.