Transcript: Mouse NM_146775.1

Mus musculus olfactory receptor 473 (Olfr473), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Olfr473 (258771)
Length:
933
CDS:
1..933

Additional Resources:

NCBI RefSeq record:
NM_146775.1
NBCI Gene record:
Olfr473 (258771)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186643 GCTGTCTCCTACATTTACATT pLKO.1 643 CDS 100% 5.625 3.375 N Olfr473 n/a
2 TRCN0000203838 CCCAAGCTGTGTATAGTCTTT pLKO.1 61 CDS 100% 4.950 2.970 N Olfr473 n/a
3 TRCN0000203775 CTGCATGAATGGTTGGACATT pLKO.1 456 CDS 100% 4.950 2.970 N Olfr473 n/a
4 TRCN0000189000 GCTGCATGAATGGTTGGACAT pLKO.1 455 CDS 100% 4.050 2.430 N Olfr473 n/a
5 TRCN0000188469 CTCTATCTCTTCTGGCTCCAT pLKO.1 597 CDS 100% 2.640 1.584 N Olfr473 n/a
6 TRCN0000185221 CCAAATCAGATAGATCACTTT pLKO.1 511 CDS 100% 4.950 2.475 Y Olfr476 n/a
7 TRCN0000203566 GAGCTAATCATCTTGGGACTA pLKO.1 31 CDS 100% 4.050 2.025 Y Olfr472 n/a
8 TRCN0000204460 CACTCTCTACTATGGGACCAT pLKO.1 744 CDS 100% 2.640 1.320 Y Olfr473 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.