Transcript: Mouse NM_146797.1

Mus musculus olfactory receptor 1502 (Olfr1502), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr1502 (258793)
Length:
951
CDS:
1..951

Additional Resources:

NCBI RefSeq record:
NM_146797.1
NBCI Gene record:
Olfr1502 (258793)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185216 CCACTATTGCTGGTATTTCTT pLKO.1 76 CDS 100% 5.625 3.375 N Olfr1502 n/a
2 TRCN0000186071 CATTGTCTTCTTTGGGAATTT pLKO.1 594 CDS 100% 13.200 6.600 Y Olfr1505 n/a
3 TRCN0000188232 CTGTGTTGGATGCCTGCTATA pLKO.1 200 CDS 100% 10.800 5.400 Y Olfr1505 n/a
4 TRCN0000189396 CCAACTCCACATCCCAATGTA pLKO.1 159 CDS 100% 5.625 2.813 Y Olfr1505 n/a
5 TRCN0000186595 GTACATACGTAGTGGTTCAAA pLKO.1 774 CDS 100% 5.625 2.813 Y Olfr1505 n/a
6 TRCN0000184912 CCAGTTCTTCTTCTTCACTAT pLKO.1 297 CDS 100% 4.950 2.475 Y Olfr1502 n/a
7 TRCN0000202681 CGCTATGTTGCTATTAGCAAT pLKO.1 364 CDS 100% 4.950 2.475 Y Olfr1502 n/a
8 TRCN0000185542 GCAAAGACTTTCTCAACATGT pLKO.1 703 CDS 100% 4.950 2.475 Y Olfr1502 n/a
9 TRCN0000186707 GCTCATCATCAAAGCTGTCAT pLKO.1 657 CDS 100% 4.950 2.475 Y Olfr1502 n/a
10 TRCN0000204124 GTCTTCAGGTAGAAGAGCAAA pLKO.1 687 CDS 100% 0.495 0.248 Y Olfr1505 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.