Transcript: Mouse NM_146840.1

Mus musculus olfactory receptor 545 (Olfr545), mRNA.

Source:
NCBI, updated 2015-12-24
Taxon:
Mus musculus (mouse)
Gene:
Olfr545 (258837)
Length:
951
CDS:
1..951

Additional Resources:

NCBI RefSeq record:
NM_146840.1
NBCI Gene record:
Olfr545 (258837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189408 CGGGACTCATTATTCGAACCT pLKO.1 605 CDS 100% 2.640 2.112 N Olfr545 n/a
2 TRCN0000185419 GCATCTACTTTCTGGTTTCTA pLKO.1 320 CDS 100% 5.625 3.938 N Olfr545 n/a
3 TRCN0000189003 GTCCTGGATATGCTCCTTCTA pLKO.1 634 CDS 100% 4.950 3.465 N Olfr545 n/a
4 TRCN0000189345 CAATGAGTCCTACACCAGCTT pLKO.1 27 CDS 100% 2.640 1.320 Y Olfr545 n/a
5 TRCN0000042800 CTGGTGATCCTCTTCACCAAT pLKO.1 118 CDS 100% 0.495 0.248 Y Olfr544 n/a
6 TRCN0000188363 CTGGTGATCCTCTTCACCAAT pLKO.1 118 CDS 100% 0.495 0.248 Y Olfr545 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.