Transcript: Mouse NM_146882.2

Mus musculus olfactory receptor 874 (Olfr874), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr874 (258882)
Length:
933
CDS:
1..933

Additional Resources:

NCBI RefSeq record:
NM_146882.2
NBCI Gene record:
Olfr874 (258882)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185613 GCTCGTAATCTTTATTGTTGT pLKO.1 585 CDS 100% 4.950 6.930 N Olfr874 n/a
2 TRCN0000202768 CCTCAGGTATATTTACTTCTT pLKO.1 409 CDS 100% 4.950 3.465 N Olfr874 n/a
3 TRCN0000202658 CTTCTTCTTGTTTCTAGGTTT pLKO.1 78 CDS 100% 4.950 2.970 N Olfr874 n/a
4 TRCN0000202616 CCATTGTCACCATCTTCATTT pLKO.1 626 CDS 100% 13.200 6.600 Y Olfr874 n/a
5 TRCN0000184868 CCCTATGTACTTCTTTCTCTT pLKO.1 168 CDS 100% 4.950 2.475 Y Olfr875 n/a
6 TRCN0000187834 GCTCCCACTTGATTGTGGTTT pLKO.1 722 CDS 100% 4.950 2.475 Y Olfr875 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.