Transcript: Mouse NM_146896.3

Mus musculus olfactory receptor 1205 (Olfr1205), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Olfr1205 (258898)
Length:
1067
CDS:
144..1067

Additional Resources:

NCBI RefSeq record:
NM_146896.3
NBCI Gene record:
Olfr1205 (258898)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146896.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030333 TGCAATTTGCTCAAGCAGTTT pLKO.1 749 CDS 100% 4.950 2.970 N Olfr1205 n/a
2 TRCN0000030331 GCTGTGACTTACAGCCCTTAT pLKO.1 670 CDS 100% 1.080 0.648 N Olfr1205 n/a
3 TRCN0000186137 CTACCTGCACATCTCATATAA pLKO.1 850 CDS 100% 15.000 7.500 Y Olfr1206 n/a
4 TRCN0000030332 CTCTACCTGCACATCTCATAT pLKO.1 848 CDS 100% 13.200 6.600 Y Olfr1205 n/a
5 TRCN0000030330 CCCATGTACTTCTTCCTGTTT pLKO.1 309 CDS 100% 4.950 2.475 Y Olfr1205 n/a
6 TRCN0000030329 GCAGGTCTGTGTCATCTTGAT pLKO.1 551 CDS 100% 4.950 2.475 Y Olfr1205 n/a
7 TRCN0000030327 CCATTTATTTGGCTGCATGGA pLKO.1 449 CDS 100% 2.640 1.320 Y Olfr1201 n/a
8 TRCN0000188152 CTACTAGGATTGACACAGGAT pLKO.1 177 CDS 100% 2.640 1.320 Y Olfr1206 n/a
9 TRCN0000030326 CCCTGCATATTCATATATGCA pLKO.1 894 CDS 100% 0.300 0.150 Y Olfr1201 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146896.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.