Transcript: Mouse NM_146906.1

Mus musculus olfactory receptor 853 (Olfr853), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr853 (258908)
Length:
918
CDS:
1..918

Additional Resources:

NCBI RefSeq record:
NM_146906.1
NBCI Gene record:
Olfr853 (258908)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194252 CAGCTTAGCTTTGTCCTACTT pLKO.1 298 CDS 100% 4.950 6.930 N Olfr853 n/a
2 TRCN0000204162 GAGTAGTGCATTAGGTGGTAT pLKO.1 606 CDS 100% 4.950 6.930 N Olfr853 n/a
3 TRCN0000186879 GCTTAATGACATTGCGTCTAT pLKO.1 479 CDS 100% 4.950 6.930 N Olfr853 n/a
4 TRCN0000187185 CCTAAGATGCTGACAAACCTT pLKO.1 235 CDS 100% 3.000 1.800 N Olfr853 n/a
5 TRCN0000204488 CCTTGTTCTATGGGACAGCTT pLKO.1 746 CDS 100% 2.640 1.584 N Olfr853 n/a
6 TRCN0000186827 GCAATGGCTTATGACCGTTAT pLKO.1 349 CDS 100% 10.800 5.400 Y Olfr1102 n/a
7 TRCN0000187390 CCACACTCCAATGTACTTCTT pLKO.1 165 CDS 100% 4.950 2.475 Y Olfr853 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.