Transcript: Mouse NM_146936.1

Mus musculus olfactory receptor 1417 (Olfr1417), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr1417 (258938)
Length:
948
CDS:
1..948

Additional Resources:

NCBI RefSeq record:
NM_146936.1
NBCI Gene record:
Olfr1417 (258938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187589 GCAGTTGACTGTGCTCATCTT pLKO.1 474 CDS 100% 4.950 2.475 Y Olfr1417 n/a
2 TRCN0000188014 CCTTTCTGTAGCAGTAAGGAA pLKO.1 502 CDS 100% 3.000 1.500 Y Olfr1418 n/a
3 TRCN0000197329 CATGATGTACCTGGTCAGCAT pLKO.1 96 CDS 100% 2.640 1.320 Y Olfr1418 n/a
4 TRCN0000186049 CCAGATGTTCTTCTTCATCTT pLKO.1 300 CDS 100% 0.495 0.248 Y Olfr1417 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.