Transcript: Mouse NM_146944.1

Mus musculus olfactory receptor 348 (Olfr348), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr348 (258946)
Length:
942
CDS:
1..942

Additional Resources:

NCBI RefSeq record:
NM_146944.1
NBCI Gene record:
Olfr348 (258946)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187302 CTGGTTTCATATGGACGCATT pLKO.1 646 CDS 100% 0.000 0.000 N Olfr348 n/a
2 TRCN0000186188 CCCTCATCAAATGACACTAAT pLKO.1 787 CDS 100% 13.200 9.240 N Olfr348 n/a
3 TRCN0000186823 GAGTCAGAGTATCTGTATCTT pLKO.1 411 CDS 100% 5.625 3.938 N Olfr348 n/a
4 TRCN0000189092 GCTACATACCTGACCACAGTA pLKO.1 100 CDS 100% 4.950 3.465 N Olfr348 n/a
5 TRCN0000186262 CTAGTCATTGAATCCTGGTTT pLKO.1 433 CDS 100% 0.000 0.000 N Olfr348 n/a
6 TRCN0000203447 CACAGTCAATCCATCTCATAT pLKO.1 265 CDS 100% 13.200 6.600 Y Olfr348 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.