Transcript: Mouse NM_146947.1

Mus musculus olfactory receptor 338 (Olfr338), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr338 (258949)
Length:
921
CDS:
1..921

Additional Resources:

NCBI RefSeq record:
NM_146947.1
NBCI Gene record:
Olfr338 (258949)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146947.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188083 CCGCATTGGAGTAACCATTAT pLKO.1 651 CDS 100% 13.200 9.240 N Olfr338 n/a
2 TRCN0000204793 GCCGCATTGGAGTAACCATTA pLKO.1 650 CDS 100% 10.800 7.560 N Olfr338 n/a
3 TRCN0000185062 CTATCTCACTTCAGAAACAAT pLKO.1 490 CDS 100% 5.625 3.375 N Olfr338 n/a
4 TRCN0000189410 CTGGGCCTTATCTTCTGCAAA pLKO.1 438 CDS 100% 4.950 2.970 N Olfr338 n/a
5 TRCN0000204031 GCTCCAAAGATGCTCGTGAAT pLKO.1 226 CDS 100% 4.950 2.475 Y Olfr352 n/a
6 TRCN0000188126 CATCTCATATGCTGGGTGTAT pLKO.1 267 CDS 100% 0.000 0.000 Y Olfr338 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146947.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.