Transcript: Mouse NM_146967.1

Mus musculus olfactory receptor 1226 (Olfr1226), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr1226 (258969)
Length:
933
CDS:
1..933

Additional Resources:

NCBI RefSeq record:
NM_146967.1
NBCI Gene record:
Olfr1226 (258969)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146967.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030378 CAGTGGGTCTATCTGCATTAT pLKO.1 603 CDS 100% 13.200 7.920 N Olfr1226 n/a
2 TRCN0000030375 CCCAATGTACTTCTTCTTAAT pLKO.1 168 CDS 100% 13.200 7.920 N Olfr1226 n/a
3 TRCN0000030376 CCTTTCTGGATGCTTGCACTT pLKO.1 197 CDS 100% 4.050 2.430 N Olfr1226 n/a
4 TRCN0000030377 CCTGCACTGACACACACATAT pLKO.1 560 CDS 100% 13.200 6.600 Y Olfr1226 n/a
5 TRCN0000030374 CCCACATTACAGTTGTGCTTT pLKO.1 722 CDS 100% 4.950 2.475 Y Olfr1226 n/a
6 TRCN0000203794 CCTGCACTGACACACACATTT pLKO.1 560 CDS 100% 13.200 6.600 Y Olfr1222 n/a
7 TRCN0000030350 GCAAGCCTCTTCACTACTCTT pLKO.1 377 CDS 100% 4.950 2.475 Y Olfr1217 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146967.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.