Transcript: Mouse NM_146987.1

Mus musculus olfactory receptor 457 (Olfr457), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr457 (258989)
Length:
942
CDS:
1..942

Additional Resources:

NCBI RefSeq record:
NM_146987.1
NBCI Gene record:
Olfr457 (258989)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146987.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188027 CCACCTGCCCATGTATTTCTT pLKO.1 165 CDS 100% 5.625 2.813 Y Olfr457 n/a
2 TRCN0000203825 CTAGCAGGTGTCTCTTGGTTT pLKO.1 430 CDS 100% 4.950 2.475 Y Olfr457 n/a
3 TRCN0000204174 GACTGTGGTCTCCATGTCTTA pLKO.1 735 CDS 100% 4.950 2.475 Y Olfr457 n/a
4 TRCN0000187848 GCTGGACTCTTTGTCCTCTTT pLKO.1 73 CDS 100% 4.950 2.475 Y Olfr457 n/a
5 TRCN0000187003 CATGTATTTCTTCCTCTGTCA pLKO.1 174 CDS 100% 2.640 1.320 Y Olfr456 n/a
6 TRCN0000203340 CCCATGTATTTCTTCCTCTGT pLKO.1 172 CDS 100% 2.640 1.320 Y Olfr457 n/a
7 TRCN0000187271 CTCAACCAAGTGGTGATACTA pLKO.1 580 CDS 100% 5.625 2.813 Y Olfr456 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146987.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.