Transcript: Mouse NM_147003.1

Mus musculus olfactory receptor 139 (Olfr139), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Olfr139 (259005)
Length:
948
CDS:
1..948

Additional Resources:

NCBI RefSeq record:
NM_147003.1
NBCI Gene record:
Olfr139 (259005)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_147003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204783 GACAGCTGTCACGGATTTCAT pLKO.1 27 CDS 100% 5.625 7.875 N Olfr139 n/a
2 TRCN0000186788 GTAAGACTGCAACCTATCCTT pLKO.1 70 CDS 100% 3.000 2.400 N Olfr139 n/a
3 TRCN0000203200 GTCTTCTTCTTTGCCTATATT pLKO.1 97 CDS 100% 15.000 10.500 N Olfr139 n/a
4 TRCN0000185655 GAAATGTAAGACTGCAACCTA pLKO.1 65 CDS 100% 3.000 2.100 N Olfr139 n/a
5 TRCN0000185654 GATACTTATCTCAGTGTCCTA pLKO.1 642 CDS 100% 2.640 1.848 N Olfr139 n/a
6 TRCN0000186184 CCACACTCCTATGTACTACTT pLKO.1 174 CDS 100% 4.950 2.475 Y Olfr248 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.