Transcript: Mouse NM_147042.2

Mus musculus olfactory receptor 1353 (Olfr1353), mRNA.

Source:
NCBI, updated 2013-04-18
Taxon:
Mus musculus (mouse)
Gene:
Olfr1353 (259044)
Length:
1266
CDS:
305..1234

Additional Resources:

NCBI RefSeq record:
NM_147042.2
NBCI Gene record:
Olfr1353 (259044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_147042.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187115 CAGGGTGCATTACCCAGATAT pLKO.1 588 CDS 100% 13.200 9.240 N Olfr1353 n/a
2 TRCN0000204033 GCCAGAAATCCCACACTTCTT pLKO.1 817 CDS 100% 4.950 3.465 N Olfr1353 n/a
3 TRCN0000184962 CAACCCATTATTTATGGTCTT pLKO.1 374 CDS 100% 4.050 2.835 N Olfr1353 n/a
4 TRCN0000193128 CTGTGAACCTAATCAGGTGAT pLKO.1 838 CDS 100% 4.050 2.835 N Olfr1353 n/a
5 TRCN0000584079 ATCTATAGTCTTAGGAATAAG pLKO_005 1169 CDS 100% 13.200 6.600 Y OR2T29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147042.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.