Transcript: Human NM_147193.2

Homo sapiens GLIS family zinc finger 1 (GLIS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
GLIS1 (148979)
Length:
2816
CDS:
568..2430

Additional Resources:

NCBI RefSeq record:
NM_147193.2
NBCI Gene record:
GLIS1 (148979)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_147193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107707 GTCTCTGGTCACCTGTGTAAA pLKO.1 852 CDS 100% 13.200 9.240 N GLIS1 n/a
2 TRCN0000107706 CCCAACAAGTGCATGTTTGAA pLKO.1 1348 CDS 100% 5.625 3.938 N GLIS1 n/a
3 TRCN0000433577 CCATCTACACAGACACCTGAA pLKO_005 2411 CDS 100% 4.050 2.835 N GLIS1 n/a
4 TRCN0000107705 GCCCTGTAACATTCCCTCGAT pLKO.1 2651 3UTR 100% 2.640 1.848 N GLIS1 n/a
5 TRCN0000107709 CCAGGGCAGTTTCCACTCCAT pLKO.1 2109 CDS 100% 0.880 0.616 N GLIS1 n/a
6 TRCN0000107708 CCACCTAGACACGAAGCCGTA pLKO.1 1512 CDS 100% 0.720 0.504 N GLIS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.