Transcript: Human NM_148903.3

Homo sapiens growth regulating estrogen receptor binding 1 (GREB1), transcript variant c, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
GREB1 (9687)
Length:
2472
CDS:
452..1681

Additional Resources:

NCBI RefSeq record:
NM_148903.3
NBCI Gene record:
GREB1 (9687)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_148903.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000299 ACTGGCAAAGAATAACCTGTT pLKO.1 1306 CDS 100% 4.050 2.835 N GREB1 n/a
2 TRCN0000273205 ACTGGCAAAGAATAACCTGTT pLKO_005 1306 CDS 100% 4.050 2.835 N GREB1 n/a
3 TRCN0000139012 CGCCTGTAATCCCAGAACTTT pLKO.1 2192 3UTR 100% 5.625 2.813 Y CCDC57 n/a
4 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1925 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148903.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.