Transcript: Mouse NM_148932.2

Mus musculus nuclear pore membrane protein 121 (Pom121), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pom121 (107939)
Length:
5602
CDS:
42..3644

Additional Resources:

NCBI RefSeq record:
NM_148932.2
NBCI Gene record:
Pom121 (107939)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_148932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246408 TGTTGGTAATGCCGGACTTAA pLKO_005 4499 3UTR 100% 13.200 18.480 N Pom121 n/a
2 TRCN0000246409 GGCACATCTACACCTACTTTC pLKO_005 3423 CDS 100% 10.800 15.120 N Pom121 n/a
3 TRCN0000246410 CTGGCTTCTGCTTCGTCTATA pLKO_005 1944 CDS 100% 13.200 7.920 N Pom121 n/a
4 TRCN0000257706 CATTCAGCAAGCCCAGTATTC pLKO_005 665 CDS 100% 10.800 6.480 N Pom121 n/a
5 TRCN0000246407 CCTCCAGACAGCAAGCTATTC pLKO_005 795 CDS 100% 10.800 6.480 N Pom121 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.