Transcript: Mouse NM_148935.2

Mus musculus forkhead box N4 (Foxn4), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Foxn4 (116810)
Length:
2970
CDS:
78..1643

Additional Resources:

NCBI RefSeq record:
NM_148935.2
NBCI Gene record:
Foxn4 (116810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_148935.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081784 GATGCACAAGTGGAAACGAAA pLKO.1 932 CDS 100% 4.950 6.930 N Foxn4 n/a
2 TRCN0000423351 TGAGACTGTGTGTACATTTAT pLKO_005 2092 3UTR 100% 15.000 10.500 N Foxn4 n/a
3 TRCN0000430335 ATGGTGAGACCCGGCTCTTAA pLKO_005 1845 3UTR 100% 13.200 9.240 N Foxn4 n/a
4 TRCN0000081786 ACACCAGGGAACAAGCCTATT pLKO.1 1611 CDS 100% 10.800 7.560 N Foxn4 n/a
5 TRCN0000081785 CGGCCTCTATGGTTCTCCGTT pLKO.1 569 CDS 100% 0.880 0.616 N Foxn4 n/a
6 TRCN0000417178 TGCAGGTGACAGGTCTCTATG pLKO_005 1525 CDS 100% 10.800 6.480 N Foxn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148935.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.