Transcript: Mouse NM_148943.2

Mus musculus ubiquitin specific peptidase 9, Y chromosome (Usp9y), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Usp9y (107868)
Length:
8094
CDS:
419..8089

Additional Resources:

NCBI RefSeq record:
NM_148943.2
NBCI Gene record:
Usp9y (107868)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_148943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030856 GCACCACAAGATAGAACATTT pLKO.1 7904 CDS 100% 13.200 10.560 N Usp9y n/a
2 TRCN0000030857 GCAGCCCAGATACATATCTTT pLKO.1 3460 CDS 100% 5.625 4.500 N Usp9y n/a
3 TRCN0000030855 CCAGCCATTGAGAGAAGTGTA pLKO.1 6371 CDS 100% 4.950 3.465 N Usp9y n/a
4 TRCN0000030854 GCTCTTACTTTACAGGATCTT pLKO.1 1688 CDS 100% 4.950 3.465 N Usp9y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.