Transcript: Human NM_152232.2

Homo sapiens taste 1 receptor member 2 (TAS1R2), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
TAS1R2 (80834)
Length:
2521
CDS:
2..2521

Additional Resources:

NCBI RefSeq record:
NM_152232.2
NBCI Gene record:
TAS1R2 (80834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358195 CTACGTCTCTATGGCATTTAT pLKO_005 2035 CDS 100% 15.000 10.500 N TAS1R2 n/a
2 TRCN0000358197 CCAACTTCCTCTCCCTATTTC pLKO_005 453 CDS 100% 13.200 9.240 N TAS1R2 n/a
3 TRCN0000014019 CCTCAGCATGACCTTCTATTT pLKO.1 2290 CDS 100% 13.200 9.240 N TAS1R2 n/a
4 TRCN0000014022 CCCTACGTCTCTATGGCATTT pLKO.1 2033 CDS 100% 10.800 7.560 N TAS1R2 n/a
5 TRCN0000358196 TCCGCTGGAACTGGATCATTG pLKO_005 603 CDS 100% 10.800 7.560 N TAS1R2 n/a
6 TRCN0000014021 CCAAGAGGACTACAGTAACTA pLKO.1 373 CDS 100% 5.625 3.938 N TAS1R2 n/a
7 TRCN0000014018 GCCAACATGAAGGGCATTGTT pLKO.1 128 CDS 100% 5.625 3.938 N TAS1R2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.