Transcript: Human NM_152259.4

Homo sapiens TOPBP1 interacting checkpoint and replication regulator (TICRR), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
TICRR (90381)
Length:
6788
CDS:
119..5851

Additional Resources:

NCBI RefSeq record:
NM_152259.4
NBCI Gene record:
TICRR (90381)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152259.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380026 GAGTGCCAGCTTCAGGTATTT pLKO_005 2270 CDS 100% 13.200 18.480 N TICRR n/a
2 TRCN0000195350 CTCTCACAGAGAGCTACATTG pLKO.1 4208 CDS 100% 10.800 15.120 N TICRR n/a
3 TRCN0000082485 CCACCTGTTACGCCAAAGAAA pLKO.1 4028 CDS 100% 5.625 7.875 N TICRR n/a
4 TRCN0000082484 CGGTGTAGAAAGACCTCTGAT pLKO.1 4268 CDS 100% 4.950 6.930 N TICRR n/a
5 TRCN0000195316 CCTTCCCTGTGTAACAGTAAA pLKO.1 6326 3UTR 100% 13.200 9.240 N TICRR n/a
6 TRCN0000082483 GCAATGTGATTGGTGCTATAA pLKO.1 6063 3UTR 100% 13.200 9.240 N TICRR n/a
7 TRCN0000380382 GTGACCAAAGTTCGAAGAAAT pLKO_005 2843 CDS 100% 13.200 9.240 N TICRR n/a
8 TRCN0000195268 CAGAAGTTAGTAAGAGTAAAG pLKO.1 5508 CDS 100% 10.800 7.560 N TICRR n/a
9 TRCN0000082486 CCCACCTGTTACGCCAAAGAA pLKO.1 4027 CDS 100% 5.625 3.938 N TICRR n/a
10 TRCN0000082487 CCCTCTCCATTTCAAACAGAT pLKO.1 5087 CDS 100% 4.950 3.465 N TICRR n/a
11 TRCN0000197286 GTAACGTCTTATCAGTGGAAG pLKO.1 4557 CDS 100% 4.050 2.430 N TICRR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152259.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.