Transcript: Human NM_152332.6

Homo sapiens tandem C2 domains, nuclear (TC2N), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TC2N (123036)
Length:
5156
CDS:
330..1802

Additional Resources:

NCBI RefSeq record:
NM_152332.6
NBCI Gene record:
TC2N (123036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152332.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424465 GTTATCAGGTGGCACAAATTA pLKO_005 1770 CDS 100% 15.000 21.000 N TC2N n/a
2 TRCN0000432006 ATTTCAGTGCTAGGCATTATT pLKO_005 2211 3UTR 100% 15.000 10.500 N TC2N n/a
3 TRCN0000427254 GATAAGTGAAGACAGTAATAA pLKO_005 1697 CDS 100% 15.000 10.500 N Tc2n n/a
4 TRCN0000413711 GAGAATATCAACCATAGATAG pLKO_005 2079 3UTR 100% 10.800 7.560 N TC2N n/a
5 TRCN0000429057 GATGGCAAAGAAGTACCATTT pLKO_005 534 CDS 100% 10.800 7.560 N TC2N n/a
6 TRCN0000059541 GCTTGGCTGTACTGAGGATTA pLKO.1 491 CDS 100% 10.800 7.560 N TC2N n/a
7 TRCN0000059539 GCCCAAGTTTAAGTTATCTTA pLKO.1 560 CDS 100% 5.625 3.938 N TC2N n/a
8 TRCN0000059538 GCCTGGATACAATTACTCTAT pLKO.1 961 CDS 100% 4.950 3.465 N TC2N n/a
9 TRCN0000059542 GCATTTCAAATCTTCAGCCAA pLKO.1 1151 CDS 100% 2.640 1.584 N TC2N n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152332.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.