Transcript: Human NM_152348.4

Homo sapiens WD repeat domain 81 (WDR81), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
WDR81 (124997)
Length:
3807
CDS:
235..2907

Additional Resources:

NCBI RefSeq record:
NM_152348.4
NBCI Gene record:
WDR81 (124997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152348.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143562 GATGGCATACACAATCTACGT pLKO.1 1530 CDS 100% 2.640 3.696 N WDR81 n/a
2 TRCN0000139828 CTCCTAGCAAGCAGGAAGTTA pLKO.1 3141 3UTR 100% 5.625 3.938 N WDR81 n/a
3 TRCN0000139206 CCTGGAGATGGCATACACAAT pLKO.1 1524 CDS 100% 4.950 3.465 N WDR81 n/a
4 TRCN0000121811 GAACAGAAGATCCTCCTTGAT pLKO.1 730 CDS 100% 4.950 3.465 N WDR81 n/a
5 TRCN0000140892 GAAGCGTTGCTACCTTCACTT pLKO.1 3172 3UTR 100% 4.950 3.465 N WDR81 n/a
6 TRCN0000140581 GACGCTGACTCAGAAGATCAT pLKO.1 1119 CDS 100% 4.950 3.465 N WDR81 n/a
7 TRCN0000143200 GTCAGAAGGCAAAGAACAGAA pLKO.1 717 CDS 100% 4.950 3.465 N WDR81 n/a
8 TRCN0000143326 GACTCAGAAGATCATCGTGTA pLKO.1 1125 CDS 100% 4.050 2.835 N WDR81 n/a
9 TRCN0000140785 GAAGCTCAGCTCTGAGAACTT pLKO.1 2796 CDS 100% 4.950 2.970 N WDR81 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152348.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.