Transcript: Human NM_152355.3

Homo sapiens zinc finger protein 441 (ZNF441), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF441 (126068)
Length:
4448
CDS:
195..2276

Additional Resources:

NCBI RefSeq record:
NM_152355.3
NBCI Gene record:
ZNF441 (126068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152355.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428721 ATGGAGATGGACCTCGTATAT pLKO_005 766 CDS 100% 13.200 18.480 N ZNF441 n/a
2 TRCN0000016241 GTCATTCAAGTTACTTACGAA pLKO.1 2068 CDS 100% 3.000 2.400 N ZNF441 n/a
3 TRCN0000428604 AGTATGGAGAAACCCTATAAG pLKO_005 2190 CDS 100% 13.200 9.240 N ZNF441 n/a
4 TRCN0000422768 GTTGTGTGGAAACGCCTTTAT pLKO_005 791 CDS 100% 13.200 9.240 N ZNF441 n/a
5 TRCN0000429347 TACTTTCAGCTTCTTACAAAT pLKO_005 2319 3UTR 100% 13.200 9.240 N ZNF441 n/a
6 TRCN0000016238 CCACTCTAAGACATGAAAGAA pLKO.1 907 CDS 100% 5.625 3.938 N ZNF441 n/a
7 TRCN0000016242 CTTCAGGTCTTCCAATTACAT pLKO.1 1559 CDS 100% 5.625 3.938 N ZNF441 n/a
8 TRCN0000016240 CCTGCTTATAGTTCCACTCTA pLKO.1 894 CDS 100% 4.950 3.465 N ZNF441 n/a
9 TRCN0000016239 CCTGCTTTCAAATACATGAAA pLKO.1 655 CDS 100% 0.563 0.394 N ZNF441 n/a
10 TRCN0000243739 GAATGTAAACAATGTGGTAAA pLKO_005 2627 3UTR 100% 10.800 5.400 Y Gm14411 n/a
11 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 2024 CDS 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152355.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.