Transcript: Human NM_152374.2

Homo sapiens chromosome 1 open reading frame 216 (C1orf216), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
C1orf216 (127703)
Length:
2628
CDS:
184..873

Additional Resources:

NCBI RefSeq record:
NM_152374.2
NBCI Gene record:
C1orf216 (127703)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263566 GACCCACCTCCTGGATTATGT pLKO_005 232 CDS 100% 5.625 7.875 N C1orf216 n/a
2 TRCN0000263565 ACAAGTCCAGGAGCGCTACAA pLKO_005 645 CDS 100% 4.950 6.930 N C1orf216 n/a
3 TRCN0000168513 GCAGGCTTGTATTAGGTGTAT pLKO.1 1262 3UTR 100% 4.950 6.930 N C1orf216 n/a
4 TRCN0000282675 CACAAGTGTGCAAGGGTATAT pLKO_005 885 3UTR 100% 13.200 10.560 N C1orf216 n/a
5 TRCN0000263567 ACAACCGGAAGGAGCTTATTC pLKO_005 803 CDS 100% 13.200 9.240 N C1orf216 n/a
6 TRCN0000172619 GCCAAGGATGCTAACGAGAAT pLKO.1 298 CDS 100% 4.950 3.465 N C1orf216 n/a
7 TRCN0000263564 GCCAAGGATGCTAACGAGAAT pLKO_005 298 CDS 100% 4.950 3.465 N C1orf216 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.