Transcript: Human NM_152424.4

Homo sapiens APC membrane recruitment protein 1 (AMER1), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
AMER1 (139285)
Length:
8407
CDS:
238..3645

Additional Resources:

NCBI RefSeq record:
NM_152424.4
NBCI Gene record:
AMER1 (139285)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152424.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142771 CCCTGACTTTCCAATCCTATA pLKO.1 7928 3UTR 100% 10.800 8.640 N AMER1 n/a
2 TRCN0000414926 CAATAGTGATGAAGGTTATTA pLKO_005 1632 CDS 100% 15.000 10.500 N Amer1 n/a
3 TRCN0000122094 CCAATAGTGATGAAGGTTATT pLKO.1 1631 CDS 100% 13.200 9.240 N AMER1 n/a
4 TRCN0000426122 GAAACCTAGCCAAGTAGTTAT pLKO_005 3629 CDS 100% 13.200 9.240 N Amer1 n/a
5 TRCN0000145261 GCTCAGTTGATTGTGACATTT pLKO.1 7747 3UTR 100% 13.200 9.240 N AMER1 n/a
6 TRCN0000144779 CCCAATAGTGATGAAGGTTAT pLKO.1 1630 CDS 100% 10.800 7.560 N AMER1 n/a
7 TRCN0000143017 CCTGCTCCAAGAAAGATCAAA pLKO.1 2360 CDS 100% 5.625 3.938 N AMER1 n/a
8 TRCN0000145421 GATGCCCTATATGAGTTCTAT pLKO.1 1744 CDS 100% 5.625 3.938 N AMER1 n/a
9 TRCN0000145397 GCTCCAAGAAAGATCAAAGTA pLKO.1 2363 CDS 100% 5.625 3.938 N AMER1 n/a
10 TRCN0000141208 CCCGTGAACAAACAGCAGAAA pLKO.1 296 CDS 100% 4.950 3.465 N AMER1 n/a
11 TRCN0000141087 CTGGTAGAGTTCACCAGCAAT pLKO.1 2554 CDS 100% 0.495 0.347 N AMER1 n/a
12 TRCN0000434193 AGGAGGAGGAAGAAGATGAAG pLKO_005 1430 CDS 100% 4.950 2.475 Y Myt1 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4010 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152424.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.