Transcript: Human NM_152491.5

Homo sapiens peptidase M20 domain containing 1 (PM20D1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
PM20D1 (148811)
Length:
2164
CDS:
61..1569

Additional Resources:

NCBI RefSeq record:
NM_152491.5
NBCI Gene record:
PM20D1 (148811)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152491.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050987 CCTAGAACTCACGAAGAACAT pLKO.1 1179 CDS 100% 4.950 3.960 N PM20D1 n/a
2 TRCN0000372327 ACACCAATGCCTATCATATTT pLKO_005 898 CDS 100% 15.000 10.500 N PM20D1 n/a
3 TRCN0000372326 ACCACGGCACTCACCATATTC pLKO_005 1069 CDS 100% 13.200 9.240 N PM20D1 n/a
4 TRCN0000050986 CATGGCTATTTGAACCACTTA pLKO.1 998 CDS 100% 4.950 3.465 N PM20D1 n/a
5 TRCN0000050984 CCAGATTCCAACAGTGACTTT pLKO.1 237 CDS 100% 4.950 3.465 N PM20D1 n/a
6 TRCN0000050983 CCCAGTTACTTCTATTGGCAA pLKO.1 1341 CDS 100% 2.640 1.848 N PM20D1 n/a
7 TRCN0000050985 CCCGAAGATCTTTCTTCATTT pLKO.1 596 CDS 100% 1.320 0.924 N PM20D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152491.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.