Transcript: Human NM_152496.2

Homo sapiens mannosidase endo-alpha like (MANEAL), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-09-16
Taxon:
Homo sapiens (human)
Gene:
MANEAL (149175)
Length:
2399
CDS:
289..996

Additional Resources:

NCBI RefSeq record:
NM_152496.2
NBCI Gene record:
MANEAL (149175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136279 GAACTGGAAAGCTGTGAAGAA pLKO.1 636 CDS 100% 4.950 6.930 N MANEAL n/a
2 TRCN0000138645 CGGAGCACTTCATCAAAGAGA pLKO.1 956 CDS 100% 3.000 4.200 N MANEAL n/a
3 TRCN0000343329 CGGAGCACTTCATCAAAGAGA pLKO_005 956 CDS 100% 3.000 4.200 N MANEAL n/a
4 TRCN0000137741 GAACAACCACAATACGCGCAA pLKO.1 732 CDS 100% 2.160 3.024 N MANEAL n/a
5 TRCN0000343327 GAACAACCACAATACGCGCAA pLKO_005 732 CDS 100% 2.160 3.024 N MANEAL n/a
6 TRCN0000135261 CGTTTCCATTACCTCCTTCAA pLKO.1 816 CDS 100% 4.950 3.960 N MANEAL n/a
7 TRCN0000135260 CCTGGGAACACTTTCATGTAA pLKO.1 1256 3UTR 100% 5.625 3.938 N MANEAL n/a
8 TRCN0000343372 CCTGGGAACACTTTCATGTAA pLKO_005 1256 3UTR 100% 5.625 3.938 N MANEAL n/a
9 TRCN0000137662 CAACAGGGTCAATGGCAAGTA pLKO.1 750 CDS 100% 4.950 3.465 N MANEAL n/a
10 TRCN0000137681 GCCAACAACCTCATGTTCATC pLKO.1 667 CDS 100% 4.950 3.465 N MANEAL n/a
11 TRCN0000135301 CCACAACAAGTAGGTTTGCTT pLKO.1 2021 3UTR 100% 3.000 2.100 N MANEAL n/a
12 TRCN0000138164 CCGAGATCGTTTCCATTACCT pLKO.1 809 CDS 100% 3.000 2.100 N MANEAL n/a
13 TRCN0000343328 CCGAGATCGTTTCCATTACCT pLKO_005 809 CDS 100% 3.000 2.100 N MANEAL n/a
14 TRCN0000135677 GATCGTTTCCATTACCTCCTT pLKO.1 813 CDS 100% 2.640 1.848 N MANEAL n/a
15 TRCN0000283430 CTGGCATGGCTGATGATAATG pLKO_005 277 5UTR 100% 13.200 7.920 N Maneal n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.