Transcript: Human NM_152568.3

Homo sapiens NK6 homeobox 3 (NKX6-3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-09
Taxon:
Homo sapiens (human)
Gene:
NKX6-3 (157848)
Length:
1683
CDS:
5..412

Additional Resources:

NCBI RefSeq record:
NM_152568.3
NBCI Gene record:
NKX6-3 (157848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152568.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017726 CGACGAGAAGATCCGCCTGCT pLKO.1 334 CDS 100% 0.000 0.000 N NKX6-3 n/a
2 TRCN0000017725 CTCCTGCATGTCTTTCTGCTT pLKO.1 141 CDS 100% 2.640 1.848 N NKX6-3 n/a
3 TRCN0000434225 GAGAACGAGGACGACGAGTAC pLKO_005 287 CDS 100% 1.350 0.945 N NKX6-3 n/a
4 TRCN0000017723 CAGACACTCCTGCATGTCTTT pLKO.1 135 CDS 100% 0.495 0.347 N NKX6-3 n/a
5 TRCN0000017724 CGACGAGTACAACAAGCCGCT pLKO.1 298 CDS 100% 0.180 0.126 N NKX6-3 n/a
6 TRCN0000017727 GTGGCGGAAGAAGAGCGCCCT pLKO.1 193 CDS 100% 0.000 0.000 N NKX6-3 n/a
7 TRCN0000422606 TGTGGTTCCAGAACCGCAGGA pLKO_005 168 CDS 100% 0.720 0.432 N NKX6-3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152568.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.